How do I do statistical analysis to solve this problem with R?

Read in the sequence read below (from an Illumina HiSeq run). Write a function that can take a sequence read like this as input and outputs a table of the frequencies of A, C, G & T (two digits for each) along with the number of base pairs in the read. Keep in mind a few things. You may wish to split the read from a single string into a vector where each element is a single base pair (or into a list if you prefer). There are numerous options but one approach would be to use the strsplit function. This will output a list (not a character vector). If you want to use the length function note that it won’t have the expected behaviour on a list (but if you look at the help for length you will see an option for this). Some other functions that may help you on your way (use R help to understand how they can be used) include: table, nchar, length, lengths, print, unlist, mode.

read_1 <- "CGCGCAGTAGGGCACATGCCAGGTGTCCGCCACTTGGTGGGCACACAGCCGATGACGAACGGGCTCCTTGACTATAATCTGACCCGTTTGCGTTTGGGTGACCAGGGAGAACTGGTGCTCCTGC"

How many English words
do you know?
Test your English vocabulary size, and measure
how many words do you know
Online Test
Powered by Examplum